Information

Vilken organism har den längsta gränsen för Hayflick?

Vilken organism har den längsta gränsen för Hayflick?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Förutsatt att jag förstår konceptet korrekt, reflekterar Hayflick-gränserna en cells förmåga till stabil delning. Dessutom skiljer sig Hayflick -gränserna för olika organismer.

Min fråga är, vilken organism har den längsta Hayflick Limit? Jag vet att människor har en som sträcker sig från 40-60, bara för att ge lite sammanhang.


Hayflick-gränsen är i allmänhet förknippad med telomerlängd. Mänskliga telomerer är lite på långsidan när arter går, men är inte extraordinära. Många mössarter och andra gnagare har till exempel långt längre telomerer än människor och har uppenbarligen mycket kortare livslängd. Det finns också en sådan sak som en "mega-telomer", som finns i ett antal fågelarter, som kan hundratals gånger längre än mänskliga telomerer.

Det finns bara en vag korrelation mellan telomerlängd och artens livslängd. Se jämförande biologi av däggdjurstelomerer: hypoteser om förfäders tillstånd och telomerernas roller vid bestämning av livslängd för en utgångspunkt. Telomerer är en del av livslängden, men förmodligen en ganska liten del.

Som sagt, jag ser inte ett uttryckligt uttalande om att de arterna med mycket långa telomerer har en högre Hayflick-gräns. Jag antar att detta beror på att Hayflick-gränsen är en extremt enkel och inte särskilt användbar beskrivning av en mycket specifik uppsättning villkor, men jag vet inte det säkert.


Pålitlighet för spridningskontroller. Hayflick -gränsen och dess nedbrytning i cancer

Detta dokument presenterar en ny teori om Hayflick -gränsen och dess roll i cancer. Hayflick-gränsen har identifierats som en felsäker mekanism som begränsar till ofarliga kloner av celler som härstammar i storlek där normala spridningskontroller har brutit ner. Malignitet uppstår när Hayflick-gränsen är inaktiverad. Det hävdas att Hayflick-gränsen beror på differentiering mot en icke-spridande stat. Redundanta utvecklingsklockor föreställs som mekanismen. Kemiska cancerframkallande ämnen och promotorer kan störa dessa klockor. Dessutom kan virala genprodukter och integration av viralt DNA stoppa utvecklingsklockan och leda till malign transformation i celler som redan har lidit mutationer i sina normala regleringsmekanismer som styr proliferation. Viral transformation kan förstås som en viral strategi för överlevnad och överföring till en ny värd. Maligna kloner kan utgöra en nisch för många långsamma virus. Normal funktion av Hayflick-gränsen innebär åldrande av vävnader på grund av differentiering mot ett icke-spridande tillstånd. Därför kan gränsen vara orsaken till senescens även om det inte beror på en ansamling av somatiska mutationer.


Innehåll

I början av 1970 -talet insåg ryska teoretikern Alexei Olovnikov först att kromosomer inte helt kunde replikera deras ändar. Byggande på detta, och för att tillgodose Leonard Hayflicks idé om begränsad somatisk celldelning, föreslog Olovnikov att DNA-sekvenser går förlorade varje gång en cell replikerar tills förlusten når en kritisk nivå, då celldelningen slutar. [1]

1975–1977 upptäckte Elizabeth Blackburn, som arbetade som postdoktor vid Yale University med Joseph G. Gall, den ovanliga naturen hos telomerer, med deras enkla upprepade DNA-sekvenser som utgör kromosomändar. [2] Blackburn, Carol Greider och Jack Szostak tilldelades 2009 års Nobelpris i fysiologi eller medicin för upptäckten av hur kromosomer skyddas av telomerer och enzymet telomeras. [3]

År 1983 fick Barbara McClintock, en amerikansk cytogenetiker och den första kvinnan som fick ett odelat nobelpris i fysiologi eller medicin, Nobelpriset för att ha observerat att kromosomerna som saknar änddelar blev "klibbiga" och antog att det fanns en speciell struktur vid kromosomspets som skulle bibehålla kromosomstabiliteten. [4]

Avsluta replikeringsproblem Redigera

Under DNA-replikation kan DNA-polymeras inte replikera sekvenserna som är närvarande vid 3'-ändarna. Detta är en konsekvens av dess enkelriktade sätt för DNA-syntes: den kan bara fästa nya nukleotider till en befintlig 3'-ände (det vill säga syntesen fortskrider 5'-3') och därför kräver den en primer för att initiera replikation. På den ledande strängen (orienterad 5'-3' i replikationsgaffeln), replikerar DNA-polymeras kontinuerligt från initieringspunkten hela vägen till strängens ände med primern (gjord av RNA) som sedan skärs ut och ersätts med DNA. Den eftersläpande strängen är emellertid orienterad 3'-5' med avseende på replikationsgaffeln, så kontinuerlig replikation med DNA-polymeras är omöjlig, vilket nödvändiggör diskontinuerlig replikation som involverar upprepad syntes av primrar längre 5' om initieringsstället (se lagging) strängreplikation). Den sista primern som är involverad i eftersläpningssträngreplikation sitter nära 3'-änden av mallen (motsvarande den potentiella 5'-änden av fördröjningssträngen). Ursprungligen trodde man att den sista primern skulle sitta i slutet av mallen, så när det väl tagits bort skulle DNA-polymeraset som ersätter primers med DNA (DNA-Pol δ i eukaryoter) [not 1] inte kunna syntetisera "ersättnings-DNA" från 5'-änden av den släpande strängen så att mallnukleotiderna som tidigare parats med den sista primern inte skulle replikeras. [5] Det har sedan ifrågasatts om den sista släpande strängprimern är placerad exakt vid 3'-änden av mallen och det visades att den är ganska syntetiserad på ett avstånd av cirka 70-100 nukleotider vilket överensstämmer med fyndet att DNA i odlad human cell förkortas med 50-100 baspar per celldelning. [6]

Om kodningssekvenser försämras i denna process skulle potentiellt vital genetisk kod gå förlorad. Telomerer är icke-kodande, repetitiva sekvenser belägna vid ändarna av linjära kromosomer för att fungera som buffertar för de kodande sekvenserna längre bak. De "kapslar" slutsekvenserna och bryts progressivt ned i processen för DNA-replikation.

"Slutreplikationsproblemet" är exklusivt för linjära kromosomer eftersom cirkulära kromosomer inte har ändar som ligger utan räckhåll för DNA-polymeraser. De flesta prokaryoter, som förlitar sig på cirkulära kromosomer, har därför inte telomerer. [7] En liten bråkdel av bakteriekromosomer (som de i Streptomyces, Agrobacterium, och Borrelia), är dock linjära och har telomerer, som skiljer sig mycket från de eukaryota kromosomerna i struktur och funktion. De kända strukturerna hos bakterietelomerer har formen av proteiner bundna till ändarna av linjära kromosomer, eller hårnålsslingor av enkelsträngat DNA vid ändarna av de linjära kromosomerna. [8]

Telomere ändar och shelterin Redigera

I själva 3'-änden av telomeren finns ett 300 baspar överhäng som kan invadera den dubbelsträngade delen av telomeren som bildar en struktur som kallas en T-slinga. Denna slinga är analog med en knut, som stabiliserar telomeren och förhindrar att telomerändarna upptäcks som brytpunkter av DNA-reparationsmaskineriet. Skulle icke-homolog ändförbindelse inträffa vid de telomera ändarna skulle kromosomfusion uppstå. T-slingan upprätthålls av flera proteiner, gemensamt kallade shelterin-komplexet. Hos människor består shelterin -komplexet av sex proteiner identifierade som TRF1, TRF2, TIN2, POT1, TPP1 och RAP1. [9] I många arter är sekvensrepetitionerna berikade med guanin, t.ex. TTAGGG hos ryggradsdjur, [10] som gör det möjligt att bilda G-quadruplex, en speciell DNA-konformation som inbegriper basparning utan Watson-Crick. Det finns olika undertyper beroende på bland annat enkel- eller dubbelsträngat DNA. Det finns bevis för att 3'-överhänget i ciliater (som har telomerupprepningar som liknar de som finns hos ryggradsdjur) bildar sådana G-quadruplex som rymmer det, snarare än en T-loop. G-quadruplexer utgör ett hinder för enzymer som DNA-polymeraser och anses därför vara involverade i regleringen av replikation och transkription. [11]

Telomeras Edit

Många organismer har ett enzym som kallas telomeras, som utför uppgiften att lägga till repetitiva nukleotidsekvenser till ändarna av DNA:t. Telomeras "fyller på" telomerens "lock". I de flesta flercelliga eukaryota organismer är telomeras endast aktivt i könsceller, vissa typer av stamceller såsom embryonala stamceller och vissa vita blodkroppar. Telomeras kan reaktiveras och telomerer återställas till ett embryontillstånd genom somatisk cellkärnöverföring. [12] Den stadiga förkortningen av telomerer med varje replikation i somatiska (kropps)celler kan ha en roll i åldrande [13] och i förebyggandet av cancer. [14] [15] Detta beror på att telomererna fungerar som en slags tidsfördröjnings-"säkring", som så småningom tar slut efter ett visst antal celldelningar och resulterar i att vital genetisk information från cellens kromosom försvinner med framtida delningar. . [16]

Längd Redigera

Telomerlängden varierar kraftigt mellan arterna, från cirka 300 baspar i jäst [17] till många kilobaser hos människor, och består vanligtvis av grupper av guaninrika, sex- till åtta baspar långa repetitioner. Eukaryota telomerer slutar normalt med 3′ enkelsträngat DNA-överhäng, vilket är väsentligt för telomerunderhåll och täckning. Flera proteiner som binder enkel- och dubbelsträngat telomer-DNA har identifierats. [18] Dessa fungerar i både telomerunderhåll och täckning. Telomerer bildar stora loopstrukturer som kallas telomerslingor eller T-slingor. Här ringlar det enkelsträngade DNA:t runt i en lång cirkel, stabiliserad av telomerbindande proteiner. [19] I slutet av T-slingan hålls det enkelsträngade telomer-DNA: t på ett område med dubbelsträngat DNA genom att telomersträngen stör det dubbel-spiralformade DNA: t och basparning till en av de två strängarna. Denna trippelsträngade struktur kallas en förskjutningsslinga eller D-loop. [20]

Roll i cellcykeln Redigera

Telomerförkortning hos människor kan inducera replikativ senescens, vilket blockerar celldelning. Denna mekanism verkar förhindra genomisk instabilitet och utveckling av cancer i mänskliga åldrade celler genom att begränsa antalet celldelningar. Förkortade telomerer försämrar emellertid immunfunktionen som också kan öka mottagligheten för cancer. [21] Om telomerer blir för korta har de potential att utvecklas från sin förmodade slutna struktur. Cellen kan upptäcka denna avveckling som DNA-skada och sedan antingen sluta växa, gå in i cellulär ålderdom (ålderdom) eller börja programmerad cellsjälvdestruktion (apoptos) beroende på cellens genetiska bakgrund (p53-status). Obegränsade telomerer resulterar också i kromosomala fusioner. Eftersom denna skada inte kan repareras i normala somatiska celler kan cellen till och med gå in i apoptos. Många åldranderelaterade sjukdomar är kopplade till förkortade telomerer. Organ försämras när fler och fler av deras celler dör eller går in i cellulär åldrande.

Oxidativ skada Redigera

Bortsett från slutreplikationsproblemet har in vitro-studier visat att telomerer ackumulerar skador på grund av oxidativ stress och att oxidativ stressmedierad DNA-skada har ett stort inflytande på telomerförkortning in vivo. Det finns en mängd olika sätt på vilka oxidativ stress, förmedlad av reaktiva syrearter (ROS), kan leda till DNA -skada, men det är ännu oklart om den förhöjda hastigheten i telomerer orsakas av deras inneboende känslighet eller en minskad aktivitet av DNA reparationssystem i dessa regioner. [22] Trots utbredd överensstämmelse mellan fynden har till exempel utbredda brister gällande mätning och provtagning påpekats, en misstänkt art och vävnadsberoende av oxidativ skada på telomerer sägs vara otillräckligt redovisad. [23] Populationsbaserade studier har visat på en interaktion mellan intag av antioxidanter och telomerlängd. I Long Island Breast Cancer Study Project (LIBCSP) fann författarna en måttlig ökning av risken för bröstcancer bland kvinnor med de kortaste telomererna och lägre kostintag av betakaroten, vitamin C eller E. [24] Dessa resultat [25] tyder på att cancerrisk på grund av telomerförkortning kan interagera med andra mekanismer för DNA-skada, särskilt oxidativ stress.

Förening med åldrande Redigera

Telomerförkortning är förknippad med åldrande, dödlighet och åldringsrelaterade sjukdomar. Normalt åldrande är associerat med telomerförkortning hos både människor och möss, och studier på genetiskt modifierade djurmodeller tyder på orsakssamband mellan telomererosion och åldrande. [26] Det är dock inte känt om korta telomerer bara är ett symptom på åldrande eller om de själva bidrar till utvecklingen av åldringsprocessen. [27]

En fars ålder spelar en roll för längden på ett barns telomerer, vilket har evolutionära implikationer. Även om leukocyttelomerer förkortas med åldern, förlängs spermietelomerer med åldern. Kortare telomerer är teoretiserade för att medföra lägre energikostnader (på grund av mindre replikation) men har också immunsystemrelaterade och andra åldrande- och sjukdomsrelaterade kostnader, så effekten av faderns ålder på telomerlängden kan vara en anpassning för att öka chanserna att barnet kommer att passa för den miljö de föds in i. [28] [29]

Potentiell effekt av psykologisk stress Redigera

Metaanalyser fann att ökad upplevd psykologisk stress var associerad med en liten minskning av telomerlängden - men att dessa associationer försvagas till inget signifikant samband när man tar hänsyn till publikationsbias. Litteraturen om telomerer som integrerande biomarkörer för exponering för stress och motgångar domineras av tvärsnitts- och korrelationsstudier, vilket gör kausal tolkning problematisk. [25] [30] En recension från 2020 hävdade att sambandet mellan psykosocial stress och telomerlängd verkar starkast för stress som upplevts i livmodern eller tidigt i livet. [31]

Fenomenet begränsad celldelning observerades först av Leonard Hayflick och kallas nu Hayflick -gränsen. [32] [33] Betydande upptäckter gjordes senare av en grupp forskare organiserad vid Geron Corporation av Gerons grundare Michael D. West, som knöt telomerförkortning med Hayflick-gränsen. [34] Kloningen av den katalytiska komponenten av telomeras gjorde det möjligt för experiment att testa om uttrycket av telomeras vid nivåer tillräckliga för att förhindra telomerförkortning kunde föreviga mänskliga celler. Telomeras demonstrerades i en publikation från 1998 i Vetenskap för att kunna förlänga cellens livslängd, och är nu välkänt som förmåga att föreviga mänskliga somatiska celler. [35]

Det blir uppenbart att reversering av förkortning av telomerer genom tillfällig aktivering av telomeras kan vara ett kraftfullt sätt att bromsa åldrandet. Anledningen till att detta skulle förlänga människors liv är för att det skulle förlänga Hayflick -gränsen. Tre vägar har föreslagits för att vända telomerförkortning: läkemedel, genterapi eller metabolisk undertryckning, så kallad torpor/viloläge. Hittills har dessa idéer inte bevisats hos människor, men det har visats att förkortningen av telomerer vänds i viloläge och åldrandet saktas ner (Turbill, et al. 2012 och 2013) och att viloläge förlänger livslängden (Lyman et al. 1981). Det har också visats att telomerförlängning framgångsrikt har vänt några tecken på åldrande hos laboratoriemöss [36] [37] och arter av nematodmaskar. Caenorhabditis elegans. [38] Det har antagits att längre telomerer och särskilt telomerasaktivering kan orsaka ökad cancer (t.ex. Weinstein och Ciszek, 2002 [39]). Men längre telomerer kan också skydda mot cancer, eftersom korta telomerer är förknippade med cancer. Det har också föreslagits att längre telomerer kan orsaka ökad energiförbrukning. [21]

Tekniker för att förlänga telomerer kan vara användbara för vävnadsteknik, eftersom de kan tillåta att friska, icke -cancerösa däggdjursceller odlas i mängder som är tillräckligt stora för att vara konstruktionsmaterial för biomedicinska reparationer.

Två studier på långlivade sjöfåglar visar att telomerernas roll långt ifrån är förståelig. År 2003 observerade forskare att telomererna från Leachs stormpetrel (Oceanodroma leucorhoa) tycks förlängas med kronologisk ålder, den första observerade förekomsten av sådant beteende hos telomerer. [40] År 2006, Juola et al. [41] rapporterade att i en annan orelaterad, långlivad sjöfågelart, den stora fregatfågeln (Fregata minor), minskade telomerlängden tills minst c. 40 år (dvs. troligen över hela livslängden), men minskningshastigheten bromsade massivt med stigande åldrar och att minskningen av telomerlängden varierade starkt mellan enskilda fåglar. De drog slutsatsen att i denna art (och förmodligen hos fregatfåglar och deras släktingar i allmänhet) kunde telomerlängden inte användas för att bestämma en fågels ålder tillräckligt bra. Således verkar det som att det finns mycket mer variation i beteendet för telomerlängd än vad man först trodde.

Dessutom Gomes et al. fann, i en studie av den jämförande biologin av däggdjurstelomerer, att telomerlängden hos olika däggdjursarter korrelerar omvänt, snarare än direkt, med livslängden, och de drog slutsatsen att telomerlängdens bidrag till livslängden förblir kontroversiellt. [42] Harris et al. hittade få bevis för att telomerlängd hos människor är en betydande biomarkör för normalt åldrande med avseende på viktiga kognitiva och fysiska förmågor. [43] Gilley och Blackburn testade om cellulär åldrande i paramecium orsakas av telomerförkortning och fann att telomerer inte förkortades under åldrandet. [44]

Kända, uppdaterade telomernukleotidsekvenser listas på Telomeras Database-webbplats.

Några kända telomernukleotidsekvenser
Grupp Organism Telomerisk upprepning (5' till 3' mot slutet)
Ryggradsdjur Människa, mus, Xenopus TTAGGG
Filamentösa svampar Neurospora crassa TTAGGG
Slemformar Physarum, Didymium TTAGGG
Dictyostelium AG(1-8)
Kinetoplastid protozoer Trypanosom, Crithidia TTAGGG
Ciliatprotozoer Tetrahymena, Glaukom TTGGGG
Paramecium TTGGG(T/G)
Oxytricha, Stylonychia, Euploter TTTTGGGG
Apicomplexan protozoer Plasmodium TTAGGG (T/C)
Högre växter Arabidopsis thaliana TTTAGGG
Cestrum elegans TTTTTTAGGG [45]
Allium CTCGGTTATGGG [46]
Grönalger Chlamydomonas TTTTAGGG
Insekter Bombyx mori TTAGG
Rundmaskar Ascaris lumbricoides TTAGGC
Fission jäst Schizosaccharomyces pombe TTAC (A) (C) G (1-8)
Knoppande jäst Saccharomyces cerevisiae TGTGGGTGTGGTG (från RNA -mall)
eller G (2-3) (TG) (1-6) T (konsensus)
Saccharomyces castellii TCTGGGTG
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA [C/A] GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

Telomerer är avgörande för att upprätthålla genomisk integritet och kan vara faktorer för åldersrelaterade sjukdomar. [47] Laboratoriestudier visar att telomerdysfunktion eller förkortning vanligen uppstår på grund av cellulärt åldrande och tumörutveckling. [47] [48] Korta telomerer kan leda till genomisk instabilitet, kromosomförlust och bildandet av icke-reciproka translokationer och telomerer i tumörceller och deras prekursorlesioner är betydligt kortare än omgivande normal vävnad. [49] [50]

Observationsstudier har funnit förkortade telomerer i många typer av experimentella cancerformer. [51] Dessutom har personer med cancer visat sig ha kortare leukocyttelomerer än friska kontroller. [52] Nyligen genomförda metaanalyser tyder på 1,4 till 3,0 gånger ökad risk för cancer för de med de kortaste kontra längsta telomererna. [53] [54] Däremot varierar riskökningen beroende på ålder, kön, tumörtyp och skillnader i livsstilsfaktorer. [51]

Flera tekniker används för närvarande för att bedöma genomsnittlig telomerlängd i eukaryota celler. En metod är Terminal Restriction Fragment (TRF) Southern blot. [55] [56] En realtids-PCR-analys för telomerlängd innefattar bestämning av förhållandet Telomere-to-Single Copy Gene (T/S), vilket har visat sig vara proportionellt mot den genomsnittliga telomerlängden i en cell. [57]

Verktyg har också utvecklats för att uppskatta längden på telomerer från hela genom -sekvensering (WGS) experiment. Bland dessa finns TelSeq, [58] telomereCat [59] och telomereHunter. [60] Längduppskattning från WGS fungerar vanligtvis genom att differentiera telomere -sekvenseringsläser och sedan utgå från längden på telomerer som producerade det antalet läsningar. Dessa metoder har visat sig korrelera med redan existerande skattningsmetoder såsom PCR och TRF. Flow-FISH används för att kvantifiera längden på telomerer i mänskliga vita blodkroppar. En halvautomatisk metod för att mäta den genomsnittliga längden på telomerer med Flow FISH publicerades i Nature Protocols 2006. [61]

Medan flera företag erbjuder tjänster för mätning av telomerlängd, har användbarheten av dessa mätningar för utbredd klinisk eller personlig användning ifrågasatts. [62] [63] Nobelprisvinnaren Elizabeth Blackburn, som var en av grundarna av ett företag, främjade den kliniska användningen av telomerlängdsmått. [64]

De flesta undersökningar om telomerlängd och reglering, och dess samband med cancer och åldrande, har utförts på däggdjur, särskilt människor, som har liten eller ingen somatisk telomerasproduktion. Ektotermer är betydligt mer sannolika än endotermer att ha variation i somatiskt telomerasuttryck. Till exempel, i många fiskar förekommer telomeras i hela kroppen (och associerat med detta är telomerlängden ungefär densamma i hela dess vävnad). Studier av ectotherms och andra organismer som inte är däggdjur visar att det inte finns en enda universell modell för telomererosion, det finns en stor variation i relevant dynamik över Metazoa, och även inom mindre taxonomiska grupper verkar dessa mönster olika. På grund av de olika reproduktionstiderna för vissa ektotermier är urval av sjukdomar relevanta för en mycket större del av dessa varelsers liv än för däggdjur, så tidiga och sena livslängder och deras möjliga kopplingar till cancer verkar särskilt viktiga i dessa arter ur en livshistorisk synvinkel. [65]


Högre organismer som vi människor är gjorda av celler, av flera hundra olika typer om man utesluter alla de symbiotiska bakteriearter som vi bär med oss. De allra flesta celler har korta ändliga livslängder: de slutar reproducera och självförstöra eller blir åldrande efter ett antal reproduktiva divisioner. Du kanske är bekant med Hayflick-gränsen i förhållande till detta ämne: det är antalet gånger en cell delar sig innan den tar sig själv från cellcykeln till ett öde av förstörelse eller åldrande. På samma sätt har du förmodligen hört talas om telomerer, de upprepande DNA -sekvenserna i slutet av våra kromosomer. Telomerernas längd förkortas med varje celldelning och bildar en sorts nedräkningsklocka, och för korta telomerer är en av mekanismerna genom vilka celldelningen stoppas.

Verkligheten på marken är mycket mer komplex än denna enkla syn på en celldelnings nedräkning. Vissa celler delar sig inte och håller dig livet ut, till exempel många av dem i centrala nervsystemet. Andra celler, såsom stamcellspopulationer, har sina telomerer upprepade gånger förlängda av enzymet telomeras. Olika celler i olika delar av kroppen har mycket olika livslängder, och den komplexa uppsättningen av processer som bestämmer dessa livslängder är mycket varierande och reagerar på miljön och på varandra.

Inget av detta har dock någon direkt påverkan på en organisms livslängd. Du kan inte bara vifta med en trollstav som skulle förlänga livslängden för alla celler och förvänta dig att se en liknande förlängning av livet i organismen - om det händer eller inte beror på de invecklade detaljerna om hur celler relaterar till organ och system. Cellernas livslängd är ända nere i maskinens djup, detaljer interna till lågnivåkomponenter som är frikopplade från hur maskinen beter sig i aggregat. Det finns ingen särskild anledning för cellens livslängd att ha något att göra med hur länge maskinen som helhet kan hålla. Vissa av våra vävnader är designade för att cykla igenom och ersätta alla deras celler mycket snabbt, på några dagar. Andra celler ersätts aldrig och lever så länge vi gör.

Cellbeteende är underordnat behoven hos organet eller systemet som de är en del av. Cellerna av en given typ utvecklades för att ha sitt nuvarande beteende och typiska livslängder eftersom de, när de agerar som ett system i samband med andra celltyper, producerar ett fungerande organ eller system som ger en viss evolutionär fördel. Om det kan göras med mycket cellomsättning och korta celllivslängder, kommer det att vara det. Om det kan göras med liten cellomsättning och långt cellliv sträcker sig det också - men båda vägarna kan producera ett långlivat och pålitligt fungerande organ. Denna punkt är en som en ny artikel så småningom kommer till, efter en rundtur i Hayflick -gränsen och telomerbiologi:

Det är sant att när vi blir äldre förkortas våra telomerer, men bara för vissa celler och bara under vissa tider. Viktigast av allt, trovärdiga laboratoriemöss har telomerer som är fem gånger längre än våra men deras liv är 40 gånger kortare. Det är därför som förhållandet mellan telomerlängd och livslängd är oklart.

Att använda Hayflick-gränsen och telomerlängden för att bedöma den maximala mänskliga livslängden är tydligen liknande att förstå det romerska imperiets undergång genom att studera Colosseums materiella egenskaper. Rom föll inte för att Colosseum försämrade Colosseum försämrades eftersom Romarriket föll.

Inom människokroppen åldras de flesta celler inte bara. De repareras, rengörs eller ersätts av stamceller. Din hud försämras när du åldras eftersom din kropp inte kan utföra sina normala funktioner för reparation och regenerering.

De processer som orsakar degenerativt åldrande sker på cellnivå och specifika proteinmaskineri i celler, vilket skadar deras förmåga att prestera som de ska. Gamla, skadade celler producerar fler gamla, skadade celler när de delar sig. Gamla, skadade stamceller lyckas helt enkelt inte hänga med i sina uppgifter med vävnadsunderhåll. Långlivade celler blir gradvis mer skadade och oförmögna eller dör tillbaka, vilket båda orsakar mycket synliga problem när det händer i nervsystemet och hjärnan.

Åldrande är helt enkelt en fråga om skada. Men hur den skadan leder till systemfel är inte en enkel fråga om celler som lever längre eller celler dör tidigare - förutom när det gäller vissa långlivade celltyper. Varje vävnad misslyckas genom samma allmänna processer, men dessa processer producerar ett mycket brett spektrum av fellägen, beroende på vävnadens karaktär och cellerna som utgör den. Gå längre än den jämförande enkelheten hos de grundläggande orsakerna till åldrande, och allt blir allt mer komplext när du går mot att beskriva den mycket varierande biologin av dödliga åldersrelaterade sjukdomar. Det är därför att ingripa i grundorsakerna är absolut den bästa och mest kostnadseffektiva strategin, den enda som sannolikt kommer att ge meningsfulla framsteg mot mänsklig föryngring i våra liv.

Som en sista anteckning, för mina pengar, skulle jag satsa på att former av amyloidos är det nuvarande yttersta begränsande tillståndet för människans livslängd. Bevisen tyder på att detta är vad som i slutändan dödar supercentenarians, de motståndskraftiga individer som har gjort det över 110 års ålder, undviker eller överlever alla dödliga åldersrelaterade medicinska tillstånd som krävde sina kamrater.

Jag älskar att läsa dessa artiklar här. Jag försöker läsa varenda en. Men jag önskar att alla ni vetenskapsmän kom överens med varandra lite oftare. Du säger att telomererosion har lite med åldrande att göra. Den här killen säger att det har allt att göra med det. Åh, jag önskar att jag hade ägnat mer tid åt att studera biologi. He he. Detta är från artikeln: "Med andra ord, telomerdysfunktion är inte bara en skyldig i den sjunkande hälsan i hög ålder. Det är kungnålen, enligt DePinho och hans kollegor."

@Nathan Voodoo: Jag tror att telomerlängd troligen är ett sekundärt inslag i åldrandet. Andra människor håller inte med. Det är också möjligt för kortare telomerer att vara en sekundär effekt av de verkliga primära orsakerna till åldrande och sedan fortsätta att orsaka ett gäng tertiära problem - så att hålla dem länge kan stoppa de tertiära problemen medan det fortfarande inte gör mycket för åldrandet. i allmänhet.

Det hela är fortfarande öppet för en rigorös beslutsamhet på ett eller annat sätt.

Det finns musstudier där boostat telomeras (och därmed längre telomerer) förlänger livet, men det är inte givet att anledningen till att detta förlänger livet är att förlänga telomererna. Telomeras gör en massa andra saker också.

Du kan komma ihåg att flera telomerlängdsmätningsföretag får riskkapitalfinansiering nu, eller har fått det nyligen, så det kommer att påverka vad pressen säger. Tänk tillbaka på vad pressen sa om resveratrol och sirtuins när det fanns mycket venture -finansiering för den forskningen - i allmänhet ser du fler artiklar som överdriver betydelsen av mekanismerna och vetenskapen som är involverade i arbetet med de venturefinansierade företagen . Det är bara så världen fungerar.

De flesta populära artiklar och nästan varje tidning talar bara om absolut telomerlängd, inte den parameter som sannolikt är mycket viktigare - erosionshastigheten, även känd som TROC, telomerhastigheten för förändring. Se till exempel:

Tack för svaret. Jag kommer att undersöka dessa saker som du har nämnt.


Åtkomstalternativ

Få full journalåtkomst i 1 år

Alla priser är NETTOpriser.
Moms tillkommer senare i kassan.
Skatteberäkningen kommer att slutföras i kassan.

Få tidsbegränsad eller fullständig artikelåtkomst på ReadCube.

Alla priser är NETTOpriser.


U S C M A – United States Colombian Medical Association

Utvecklade biologin ett sätt att skydda avkomman från åldrande härjningar genom att skapa en fysisk barriär som skiljer föräldern från dess unga?

idén att varje organism måste åldras var ett koncept som förvånade många biologer. Under lång tid trodde man att åldrande var en process som endast inträffade hos flercelliga organismer. Anledningen till denna förmodligen udda presumtion var att vi kände somatiska celler - som de som består av njuren, hjärnan och levern - förlorade sin funktionalitet med tiden: de åldrades. Dessutom delade sig dessa celler bara ett begränsat antal gånger, cirka 50, varefter de nådde den så kallade Hayflick-gränsen, slutade sprida sig och dog.

Unicellulära organismer ansågs kunna dela sig för evigt, så länge förhållandena tillåter: en generation som föder den nästa genom tiden - ett slags odödlighet. Om encelliga organismer var som somatiska celler, skulle de åldras när de delar sig, nå Hayflick -gränsen och dö.

Det var inte förrän på 1950-talet som forskare som tänkte på åldrande började ändra uppfattning. Det blev klart att dottercellerna hos vissa encelliga organismer verkade föryngras, börja från början, medan modercellerna ackumulerade de cellavvikelser som signalerade åldrande. Detta åldringsmönster sågs hos sådana evolutionärt avlägsna organismer som Saccharomyces cerevisiae, känd som spirande eller bakersjäst, och bakterier som Caulobacter crescentus och Escherichia coli. 1–3 Åldrande verkar vara en universell egenskap för alla levande varelser.

För mig väckte den insikten en mer grundläggande fråga, en som vi som biologer knappt får begrunda: Varför tillåter celler att vissa misstag ackumuleras? If evolution is such a powerful process—one that finds solutions to all manner of problems—how could there be processes or problems that can’t be fixed?


Telomeres - Biological Clock

In principal, bacteria can live forever. If a bacterial cell is housed in good conditions it will continue to divide and increase in size indefinitely. Cells of higher organisms like birds or mammals work slightly differently. Until the middle of the 20th century, it was believed that cells in all species could also live forever. However, in 1912, a scientist at the Rockefeller Institute named Alexis Carrel performed a study designed to study the length of time a chicken fibroblast would divide for. Fibroblasts are the connective tissues cells that increase the strength of the three dimensional framework that is the main support of other cells. Carrel fed the cells a broth that was made from chicken embryos, feeding them on a regular basis. Excess cells were discarded on a periodic basis. The fibroblasts continued to divide for years without any sign of slowing until 30 years later when the experiment was ended (after Carrel's death). It showed that in a specially controlled environment the cells of higher organisms can also be immortal.

It took until the 1960's for a study that conflicted with Carrels results to be done. Leonard Hayflick's study of human fibroblasts, maintained in a similar set of conditions to those of Carrel, would only divide about 50 times and then cease. Which one had the more valid methods? It seems that it was Carrel's experiment was the flawed one. Because the nourishing broth that he used to feed the cells had a low level content of chicken fibroblasts he was inadvertently adding new cells on a regular basis. This problem was resolved by Hayflick who showed that there was a maximal number of divisions that a cell could make in controlled conditions this came to be known as the Hayflick limit.

The Hayflick limit can be considered a genetic program that limits the number of times a cell can divide. The reason for this limitation is that it reduces the likelihood of uncontrolled cell growth that can result in cancer. Several studies have shown that in cancer cells the genetic clock doesn't have a time limit thus allowing the cells to divide indefinitely.

Over time, the reason for the Hayflick limit was discovered. Chromosomes in higher organisms are capped with telomeres which are a special kind of DNA structure. The primary purpose of the telomeres is to prevent the ends of the chromosomes from degenerating. The process of DNA replication is what happens when the chromosomes are duplicated through cell division. Due to the way this process works, the tips of the telomeres cannot be effectively replicated. This means that the telomeres grow progressively shorter after each time the cell divides. It seems that once the cells telomeres have reached a certain length the cell ceases to be able to divide. (This isn't the case in bacteria because they have circular cells that do not include telomeres). After approximately 50 divisions, the fibroblasts not only cease to be able to divide by them also take on a different "look" and behavior. The metabolic rates of the fibroblasts slow down they grow in size and also accumulate lipofuscin which is the pigment that causes age spots. This is known as cellular senescence.

Could aging be explained as what happens once cells have reached the Hayflick limit and are no longer able to divide? There is no conclusive answer to that question at this time. It seems that in certain tissues, including the skin and the lining of blood vessels the Hayflick limit may be a key to the aging process. An example is the increased advancement of vascular diseases with age that might be in part caused by the decreased ability of vascular epithelial cells to divide. The Hayflick limit may also be a factor in age related changes to the skin as an increased number of dermal fibroblasts attain the state of senescence. Yet interestingly, the brain cells as well as cells in the nerves, muscles and retina do not normally divide, which means that they would not reach the Hayflick limit.

The Hayflick limit does not apply to all cells. Germ cells (the cells that turn into ova or sperm) and cancer are obviously immortal. Embryonic stem cells (and possibly some adult stem cells) also have the potential to be long lived or even immortal. When a store of immortal stem cells is present in certain tissues (such as skin) the buildup of dysfunctional cells that reaches the Hayflick limit seems to be a problem. The majority of cells do not die when they reach the Hayflick limit rather they enlarge and lose the majority of their practical functions. They also slow, and can cause problems with younger cells. It has been observed that the skin of older people has three times as many senescent fibroblasts then that of younger people. The accumulation of senescence and its resulting loss of capacity can have an effect on a number of different tissues.

There is a way to override the Hayflick limit. Certain mutations in cancer cells do indeed override the Hayflick limit. There are also certain viruses that have a similar effect. These viruses include the papilloma virus that immortalizes the cells that it infects. A cellular mechanism that overrides the Hayflick limit has been discovered. There is a particular gene that encodes an enzyme (telomerase) which has the ability to restore shortened telomere. The cells in which telomerase has had an effect appear to be immortal. Most normal cells have a more suppressed telomerase activity which keeps them from dividing beyond a certain limit. Scientists have discovered that in embryonic stem cells the Nanog gene is activated thus making them immortal. INKa is another gene that is an active part of senescence. INKa's role is to encode the P16 protein which helps to prevent cancer by inducing cellular senescence. Mice that have P16 were proven to have less senescent cells then there are in regular mice. The tissues of these mice have more regenerative capacity with age. At the same time the mice with less P16 had a reduced lifespan due to a higher rate of cancer.

The Hayflick limit has an effect on age related changes and certain tissue based diseases (primarily based in the blood and skin). Eradicating the Hayflick limit would cause increase the possibility of cancer. It also seems that the number of times a cell dives before it hits the limit is not prescribed. Various environmental factors can accelerate or retard the cellular clock. Raised levels of free radical formation have been proved to shorten the Hayflick limit. Other substances have been shown to extend the limit in certain types.

How can the effect of the cellular clock be minimized when it comes to the aging process? Research is beginning to show that we will be able to use genetic engineering to alter the system that produces the Hayflick limit. This is still in the experimental stages and the problem with it at the moment is that it seems that the side effects would be an increased possibility of cancer. Scientists are also looking into a way to remove senescent cells from the tissues without causing any residual damage. At the moment all that we can do is avoid unnecessary cell division. Avoiding these cell divisions can be done by lowering exposure to the factors that cause it. All kinds of cellular stress and tissue damage can result in cell division. This is particularly true of free radicals, inflammation, mutagens, certain toxins and UV radiation all of which have been proved to raise levels of cell division. Antioxidants appear to have the opposite effect. Garlic extract might be a regular everyday substance that can limit the Hayflick limit to a small extent. More clinical studies are required to prove its practical effects.


Innehåll

Belief of cell immortality

Prior to Hayflick's discovery, it was believed that vertebrate cells had an unlimited potential to replicate. Alexis Carrel, a Nobel prize-winning surgeon, had stated "that all cells explanted in culture are immortal, and that the lack of continuous cell replication was due to ignorance on how best to cultivate the cells". He supported this hypothesis by having cultivated fibroblasts from chick hearts, and to have kept the culture growing for 34 years. [ 3 ] This indicated that cells of vertebrates could continue to divide indefinitely in a culture. However, other scientists were unable to reproduce Carrel's result.

In fact, Carrel's result was due to an error in his experimental procedure: chick embryonic stem cells were added to the culture daily. This allowed for the cultivation of new fresh cells in the culture, and not simply the infinite reproduction of the original cells present in the culture. [ 1 ] It has been speculated that Carrel knew about the error, but he never admitted it. [ 4 ] [ 5 ]

Experiment and discovery

Dr. Leonard Hayflick first became suspicious of Carrel’s theory while working in a lab at the Wistar Institute. Hayflick was preparing normal human cells to be exposed to extracts of cancer cells when he noticed the normal cells had stopped proliferating. At first he thought that he had made a technical error in preparing the experiment, but later he began to think that the cell division processes had a counting mechanism. Working with Paul Morehead, he designed an experiment that showed the truth about normal cell division.

The experiment proceeded as follows. Hayflick and Morehead mixed equal numbers of normal human male fibroblasts that had divided many times (cells at the 40th population doubling) with female fibroblasts that had divided only a few times (cells at the 10th population doubling). Unmixed cell populations were kept as controls. When the male ‘control’ culture stopped dividing, the mixed culture was examined and only female cells were found. This showed that the old cells ‘remembered’ they were old, even when surrounded by young cells, and that technical errors or contaminating viruses were unlikely explanations as to why only the male cell component had died. [ 1 ] [ 6 ] The cells had stopped dividing and become senescent based purely upon how many times the cell had divided.

These results disproved the immortality theory of Carrel and established the Hayflick Limit as accredited biological theory which, unlike the experiment of Carrel, has been reproduced by other scientists.


The Hayflick limit has been found to correlate with the length of the telomeric region at the end of chromosomes. During the process of DNA replication of a chromosome, small segments of DNA within each telomere are unable to be copied and are lost. ⎖] This occurs due to the uneven nature of DNA replication, where leading and lagging strands are not replicated symmetrically. ⎗] The telomeric region of DNA does not code for any protein it is simply a repeated code on the end region of linear eukaryotic chromosomes. After many divisions, the telomeres reach a critical length and the cell becomes senescent. It is at this point that a cell has reached its Hayflick limit. ⎘] ⎙]

Hayflick was the first to report that only cancer cells are immortal. This could not have been demonstrated until he had demonstrated that normal cells are mortal. Α] Β] Cellular senescence does not occur in most cancer cells due to expression of an enzyme called telomerase. This enzyme extends telomeres, preventing the telomeres of cancer cells from shortening and giving them infinite replicative potential. ⎚] A proposed treatment for cancer is the usage of telomerase inhibitors that would prevent the restoration of the telomere, allowing the cell to die like other body cells. ⎛]


CINEMA SCIENCE: The Dangerous Biology of Annihilation: A thought-provoking, high-concept sci-fi thriller, Alex Garlands film touches on real-world phenomena such as Hox genes, the Hayflick limit and the Mandelbrot set. While its science is complex and its subject matter can be intense, the film provides many excellent opportunities for discussions about biology in senior secondary classrooms, as DAVE CREWE describes.

Typically, the films selected for Cinema Science are relatively mainstream--movies you can expect the average high school student to have heard of, if not seen. Annihilation (2018) is different. Despite its formidable pedigree (written and directed by Alex Garland, starring the likes of Natalie Portman, Jennifer Jason Leigh and Tessa Thompson), this sci-fi film proved too cerebral for Paramount, which infamously dumped the end product onto Netflix. Consequently, Annihilation only received a theatrical release in North America and China (1)--hardly the typical trajectory of a mainstream movie.

But Annihilation boasts something not necessarily shared by its blockbuster competitors: accessibility. Some 38 per cent--and rising--of the Australian population have access to Netflix, (2) so many of your students will be able to watch Annihilation. even if they haven't yet. Annihilation also possesses a robust scientific spine adapted from Jeff VanderMeer's eponymous 2014 novel and inspired by thoughtful sci-fi forebears like Stalker (Andrei Tarkovsky, 1979), (3) 2001: A Space Odyssey (Stanley Kubrick, 1968) (4) and The Thing (John Carpenter, 1982), (5) Garland's film slithers through cellular biology, optical phenomena and our genetic code on its way to a decidedly ambiguous conclusion.

Annihilation is best suited to senior secondary Science classrooms, both for the complexity of its scientific subject matter and for the graphic nature of its content: the film features some gory and legitimately horrific scenes.

Annihilation's protagonist, Lena (Portman), is a professor at Johns Hopkins University researching 'the genetically programmed life cycle of a cell'. (6) That research isn't what leads her into the 'Shimmer'--an iridescent, extraterrestrial area. She's there searching for clues to save her husband, Kane (Oscar Isaac), a soldier who's the first to safely return from within the Shimmer but is shortly thereafter afflicted with an unexplained ailment. But Lena's knowledge of cells proves crucial to understanding the nature of what's occurring within the Shimmer, just as cellular biology reveals itself as the thematic and narrative foundation of the film.

That's reflected in something as simple as the short scene showing Lena teaching a class. 'All cells were ultimately born from one cell,' she tells her students.

A single organism, alone on planet Earth, perhaps alone in the universe. About 4 billion years ago, one became two. Two became four. Then eight, sixteen, thirty-two. The rhythm of the dividing pair, which becomes the structure of every microbe, blade of grass, sea creature, land creature and human. The structure of everything that lives. and everything that dies.

This scene could be used as stimulus for a lesson on cellular division - not just in a Biology or a Mathematics classroom, where you might model the exponential growth of a dividing cell.

As teachers, we become proficient at spinning simple stimuli like this scene into an extended exploration of a topic within the curriculum, allowing the germ of an idea to - much like a dividing cell - multiply into bigger and more sophisticated concepts. Annihilation's interest in the cell and its reproductive process extends beyond this short scene. Within the Shimmer, on more than one occasion Lena observes an apparently normal cell split into a second one: a cell pulsing with colour, its rainbow cilia flailing. At the film's climax, Lena encounters the 'Entity': an enigmatic organism that mimics her movements. We watch it form from a single cell dividing, growing and, ultimately, mirroring its progenitor. At its thematic core, the film features the key processes of reproduction: doubling, mirroring, mutation.

Annihilation is a perfect starting point to explore how intimately mutation is intertwined with such reproductive processes. The film is filled with extraordinary, inexplicable mutations. Some of these are beautiful, as when a single plant sprouts into a bounty of colourful flowers, or different species grow from the same root. Lena stumbles upon an elk with flowers sprouting from its antlers and then watches as - almost imperceptibly--it splits into a second elk. (7) More often, the mutations are horrific: An albino crocodile's maw filled with shark's teeth. Human intestines contorting into writhing eels. A terrifying bear-like creature mimicking the screams of its human victims.

These mutations aren't realistic, necessarily they represent the power of the Shimmer - and its threat. As a jumping-off point, though, these transformations allow for discussion around the intersection of cellular division, mutation and evolution. Without the imperfections in this process, we would've never progressed beyond simple organisms. The alacrity of the mutations within the Shimmer, then, suggests the magnitude of the threat offered to our species, even as Garland keeps his cards close to his chest regarding the Shimmer's nefarious intentions--or lack thereof. (8)

One of the film's most enduring images is a family of trees awkwardly arched into human poses, branches grasping like arms - skeletons that never were bodies, solid shadows of humanity. One of the scientists accompanying Lena into the Shimmer, Josie (Thompson), offers a hypothesis: 'Do you know what you'd get if you sequenced [that leaf]? [. ] Human Hox genes.' Lena explains that Hox genes 'define the body plan, the physical structure'.

That isn't quite how human Hox genes work you wouldn't expect a tree to grow into a person thanks to a bit of gene splicing. But it resembles reality closely enough to prompt classroom discussions and/or investigations. As Dr Adam Rutherford--scientific adviser on Annihilation (as well as on Garland's previous film, 2014's Ex Machina) - puts it, Hox genes 'lay out the polarity of the organism': 'When [Josie] is talking about them, she's trying to rationalize how you could be seeing plants growing in human form, because that runs counter to our own scientific understanding of the gene.' (9) There's more than enough material here to allow for a research project wherein students explore the properties of Hox genes and how they're represented in Annihilation.

Another question worth investigating: could we make cells immortal? No, I'm not engaging in idle conjecture this is a question posed within the film itself. In a pre-Shimmer flashback, Lena explains the notion to her husband: 'You take a cell, circumvent the Hayflick limit, you can prevent senescence [. ] It means the cell doesn't grow old it becomes immortal.' Sure sounds like science fiction, but this isn't entirely outside the realm of possibility.

The Hayflick limit Lena is referring to describes cells' inability to divide forever. Each time a cell undergoes mitosis, its telomeres--genetic sequences found at the ends of chromosomes --degrade until, eventually, the consistency of the chromosome deteriorates beyond the point where reproduction can continue. Ageing, dying: senescence. But not all cells are subject to this phenomenon. In fact, the cell division Lena shows her class is that of a HeLa cell, (10) an 'immortal' cell discovered in 1951 and subsequently widely used in scientific research due to its resistance to senescence.

* Lobsters are sometimes described as 'immortal' as their cells don't experience senescence. Evaluate this claim.

* How do Hox genes work? Is their representation in Annihilation scientifically accurate?

* What are the different types of cellular division?

CANCER AND SELF-DESTRUCTION

Alex Garland has said that he starts his films with a central idea. For Annihilation, it was self-destruction, so it's no coincidence that Lena has the profession she does and works with cancer cells.

The HeLa cell isn't just any cell. It stems from a sample of cervical cancer cells taken from Henrietta Lacks, after whom the cells were named. And, while it's interesting to explore the ramifications of immortal cells both inside and outside the context of Annihilation, the HeLa cell mostly closely resonates with Garland's intentions because of its cancerous origins.

Fundamentally, Annihilation is a film about cancer. It's a film about unbridled growth and mutation, a film about how something as apparently innocent as cellular division can manifest itself as something terrifying, something fatal. The screenplay is dotted with explicit references to cancer in humans: Cass (Tuva Novotny) lost her daughter to the disease, while Dr Ventress (Leigh) has herself been diagnosed with terminal cancer. I regard these as Garland's signposts, providing his audience with a framework to make sense of an often-confusing narrative.

To understand these signposts, one needs to understand the properties of cancer itself. As explained by the Australian Cancer Council, cancer is a disease of the body's cells. Normally cells grow and multiply in a controlled way, however, if something causes a mistake to occur in the cells' genetic blueprints, this control can be lost. Cancer is the term used to describe collections of these cells, growing and potentially spreading within the body. (12)

Essentially, cancer is a genetic error - much like the mutations that drive evolution - that turns our cells' multiplicative tendency against us. In other words: self-destruction.

The antagonist of Annihilation--the Entity, the Shimmer, whatever you want to call it--embodies these mechanics. The influence of the Shimmer is mutative, twisting and warping genetic code. But the Entity itself, which mirrors Lena's and Kane's movements and assumes their forms, strikes me as cancerous on a global scale. While the Entity's intentions remain unclear, the conclusion of the film, with Entity-Kane and Lena (perhaps herself an offshoot of the Entity) tentatively reunited, suggests that it exists to reproduce and consume Earth organisms--including, naturally, humanity.

Cancer is a fascinating subject for any Biology classroom. To examine cancer is to understand the incredible potential of our biological processes and the multivalent possibilities of mutation, but also to recognise the threat of unbridled reproduction. Understanding cancer is more than academic, of course. The better we understand a disease, the better we can fight it. Recognising that cancer is, fundamentally, our own cells turned against us will allow students to comprehend the need for debilitating treatments like radiation therapy, whereby we poison our cells in order to fight the cancer.

'The cure for cancer' remains science's holy grail, so why not spend a lesson--or an entire assessment task - with your class exploring scientists' attempts to refine cancer treatments. Just recently, for instance, a woman was cured of advanced breast cancer through a trial that used gene therapy to, in essence, rewrite her immune system to target the cancer cells specifically. As reported by New Scientist, 'It's the first time this type of therapy has worked in breast cancer, suggesting that it may be able to help many more people with common types of cancer'. (13) Understanding this therapy requires a sophisticated grasp of genetics, the human immune system and cancer--an excellent opportunity for a senior secondary Biology activity.

* What kinds of methods are currently used to treat cancer? What are the limitations and side effects of these treatments?

* How is cancer an example of 'self-destruction'?

For me, the most enduring image of Annihilation isn't the iridescent sheen of the Shimmer, nor the corrupted bear-creature that stalks our heroines. Rather, I remember the simple, repeated shot of a hand (or hands) through a glass of water, reflected by the bending of the light. This mundane inversion characterises the sensation of watching Annihilation, seeing the ordinary flipped into something ambiguously sinister.

There's nothing miraculous about these images. They're a simple example of how refraction can cause reflection, as the light bends while travelling through the glass and the water within. It's trivially easy to replicate this phenomenon with your class all you need is a glass of water and a piece of paper. (14) Draw an arrow - or any shape for which the reflection will be obvious--and observe it through the water. From the right vantage point, the image will be reflected horizontally. But ask your students to adjust the position of the paper, the glass and/or themselves, and they should find that it isn't always reflected.

This simple experiment is an engaging introduction to a Physics unit on optics - specifically, refraction. Investigating this phenomenon requires an understanding of refractive index, focal points and other key features of optics. Linking back to Annihilation, you could tie these principles into the multicoloured appearance of the Shimmer: we observe similarly colourful displays in, say, soap bubbles. The applications for these phenomena are manifold for instance, without the principles of refraction, we wouldn't have access to the optical-fibre technology that powers the fast internet that allows you to stream Annihilation in HD--well, depending on your provider. (Rather cleverly, Garland and director of photography Rob Hardy incorporate refractive phenomena into the very look of the film. For example, they're not shy about keeping lens flares in their shots--flares caused by the refraction of bright light.)

Refraction is referenced in Annihilation outside of these moments. It's offered as an explanation for why the squad can't communicate outside the Shimmer with their radios. As Josie explains, 'The light waves aren't blocked they're refracted, and. it's the same with the radios. Signals aren't gone. They're scrambled.' She extrapolates this observation to apply to the fantastic mutations seen within the Shimmer: 'The Shimmer is a prism, but it refracts everything. Not just light and radio waves. Animal DNA. Plant DNA. All DNA.'

We're venturing further into science fiction than accepted science here - and it's worth clarifying that Josie's explanation is a hypothesis that remains unproven within the diegesis--but the notion of refracted matter is far from fiction. At the core of quantum mechanics is wave--particle duality: simply put, every piece of matter is at once a particle and a wave. By definition, waves are subject to refraction, so every piece of matter can, in fact, be refracted. Exploring the associated physics of this is perhaps beyond the scope of a typical high school classroom, but it could be a worthy extension activity for interested pupils.

* How does refraction explain a glass of water reflecting the image behind it?

* Investigate how fibre optics uses refractive properties to transmit information.

A common misconception about Mathematics is that it is dry and deterministic, lacking beauty and artistry. There are few better ways to dispute this viewpoint than the Mandelbrot set: a beautiful, fractal picture of infinite possibilities. This set is, in fact, what the Entity's appearance was modelled after per Rutherford, 'The Mandelblob is an animated 3D manifestation of the Mandelbrot set. That's what the alien is when you see it.' (15)

For junior secondary Mathematics students, this represents a prime opportunity to simply show off the wonder of the Mandelbrot set and, perhaps, associated Julia sets. More advanced mathematicians might wish to explore the underlying mathematics of the Mandelbrot set: how it is generated through iterative series on the complex plane, and even its unexpected ties to chaos mathematics.

You would expect your students to be familiar with the term 'annihilation' as a synonym for 'destruction'. But, as part of the right Physics topic, you could hook into the scientific definition of the term: the collision of a particle and its antiparticle. What are antiparticles? Ah, well, that's a whole 'nother discussion.

If you're really feeling like a deep dive into the foundations of science, Annihilation provides an opportunity to examine the core of scientific discovery. The Hollywood Reporter's Ciara Wardlow argues that Annihilation 'presents one of the best meditations I have ever seen on the metaphysics of scientific inquiry--about the fundamental nature of science that, ironically, cannot in itself be investigated through the scientific method'. Examining what Wardlow is talking about--that 'at the heart of good science is a vein of self-destruction', that our perception of science is torn between 'fascination and repulsion' (16)--necessitates the kind of deep consideration of science that's simultaneously challenging and intensely rewarding.

(1) David Sims, 'The Problem with Annihilation's Messy Release', The Atlantic, 31 January 2018, <https://www.theatlantic.com/entertamment/archive/2018/01/annihilation-paramount-netflix/551810/>, accessed 27 June 2018.

(2) 'Netflix Hits New High in Australia--7.6 Million', media release, Roy Morgan, 28 September 2017, <http://www.roymorgan.com/findings/7343-netflix-subscriptions-june-2017-201709270713>, accessed 27 June 2018.

(3) Jordan Raup, 'Go Behind-the-scenes of Alex Garland's Stalker-inspired Sci-fi Drama Annihilation, The Film Stage, 7 July 2016, <https://thefilmstage.com/news/go-behind-the-scenes-of-alex-garlands-stalker-inspired-sci-fi-drama-annihilation/>, accessed 29 June 2018.

(4) Gav Murphy, 'Alex Garland's 4 Biggest Sci-fi Influences', IGN, 13 December 2017, <http://au.ign.com/articles/2017/12/13/alex-garlands-4-biggest-sci-fi-influences>, accessed 29 June 2018.

(5) Peter Debruge, 'Film Review: Annihilation', Variety, 21 February 2018, <https://variety.com/2018/f1lm/reviews/annihilation-review-natalie-portman-1202706321/>, accessed 29 June 2018.

(6) Dialogue from the film, as spoken by Dr Ventress.

(7) A real 'blink-and-you'll-miss-it' moment. It wasn't until my third time through the film that I realised the second elk wasn't simply behind the first.

(8) There are more than a few ways to interpret the film's ending, which is clearly intended to deliver more questions than answers. Whatever the Shimmer 'wants', it's not necessarily malicious. As Lena puts it in her debrief, 'It wasn't destroying. It was changing everything. It was making something new.'


Titta på videon: Avstrija odpira mejo danes, (Februari 2023).